"OH, so you LEFTISTS want to KILL the FASCISTS? Doesn't that make YOU the SAME as FASCISTS?" No, because I don't want fascists to be killed. Castration will do.
Of course, in a year or so, this will be used in a trailer for BBC iPlayer that promises "jaw-dropping drama". Just prepare yourselves for that.
#DoctorWho
@MaxKashevsky
There are also sites that copy the text exactly, but add pictures scooped from the internet based on keywords. These are much, much worse.
I WROTE THAT! Good grief, I'd forgotten. Of course, in 1999, nobody shouted "woke" at you if you wondered whether theoretical body-shifting people are ever really gendered. (Q.v. Aaronovitch's version of the Doctor as a West African demigod, joining a dance only women can dance.)
Sooooo there's this sentient house inhabited by an extended family of prophecy-haunted oddballs, except it's been in decline ever since the departure of a never-to-be-named relative whose connection to space-time was too weird even for them. His return heralds the house's destruc
Jubilee Synagogue, also known as the Jerusalem Synagogue, is a synagogue in Prague, Czech Republic. It was built in 1906 and designed by Austrian architect Wilhelm Stiassny in Moorish Revival form with Art Nouveau decoration.
Whoever scheduled this episode of "Strictly" clearly didn't grow up in the '70s. The "Grandstand" routine should be IMMEDIATELY FOLLOWED by the "Doctor Who" routine. That is the protocol.
#Strictly
Right-wing Twitter having a meltdown about the end of "free speech" because Stewart Lee has chosen to take his *own* work off Spotify as a protest.
Being able to withdraw your own material as a protest is... y'know... pretty much the most basic requirement of "free speech".
THREAD: I review every Doctor Who / Magic: The Gathering card that's based on the original series, as they're revealed. (I'm buggered if I'm doing the new series as well, I've spent enough of my life complaining about River Song.)
#MTGxWHO
*
*Yeah, this is a pre-existing hashtag.
Nobody else seems to be mentioning it, so here it is: the moment when John Constantine meets a coked-up Prince Andrew, who's involved in a sadistic underground club for the super-rich. ("Hellblazer"
#53
, 1992.)
A
#DoctorWho
-loving friend came over, and we re-watched "The Church on Ruby Road" together. On second viewing, I'm moving it up from "yeah, that was a nice bit of fun for Christmas" to "actually, this is genuinely really good".
My five favourite (genuine) titles of deleted Wikipedia articles:
- 1933 in Video Gaming
- Judaism and bus stops
- Blowing up Wales
- World's second-largest ball of Anna Nicole Smith's navel lint
- Werewolf with robot hands
Reminder that Bagpuss has a special sea captain's hat and claims it's from the days when he was "Captain Bagpuss". Never mind "Better Call Saul", this is the prequel series we deserve. (Just check out that guy with the concertina.)
"Thunderbirds" has really dated badly, hasn't it? These days we know that if a billionaire owned a fleet of experimental rescue vehicles, he'd send them into the field without testing, get in the way of the official rescue effort, then accuse the rescuers of being child abusers.
This week on Biological Determinism vs Humanity: men who enjoy sex with women are gay, transgender people obviously regret transitioning even though we haven't bothered asking them, Palestinian children are genetically evil.
Even early-20th-century eugenicists weren't this shit.
Honestly, I was expecting the overlap of people who've seen "Encanto" and people who remember "Lungbarrow" to be rather smaller.
I was a "Doctor Who" person in the 1990s, and we thought fandom was camp *then*. If you'd told us that by 2022 we'd be referencing Disney musicals -
In 1984, Mattel introduced "She-Ra, Princess of Power" to its Masters of the Universe range. That same year saw American serial killer Richard Ramirez, AKA "the Night Stalker", begin his reign of terror.
What's astonishing is how the meaning (or at least implication) of the term "AI" has shifted in less than two years. "AI could destroy civilisation" used to mean "humans could be wiped out by robots", now it means "human culture could be wiped out by awful artless greedy people".
A very nice man called Keith just came round with a camera and some lights to interview me about '90s Doctor Who novels. I tried to wear my mask (the rabbit one), but it kept slipping off my nose, so he got loads of footage of my blushing-red face intensely leaning into the lens.
Of course, nobody can hear the name of our new monarch without thinking of the iconic King Charles spaniel.
Characterised by a high domed forehead, big floppy ears, a perpetually baffled expression, and congenital problems caused by generations of in-breeding, th
A
#DoctorWho
-loving friend came over, and we re-watched "The Church on Ruby Road" together. On second viewing, I'm moving it up from "yeah, that was a nice bit of fun for Christmas" to "actually, this is genuinely really good".
"Babybel" implies the existence of the Mother Bel, a vast queen-cheese deep in the subterranes of rural France who secretes her rind-armoured larvae through uncountable uterine edam ducts. Bon appétit, mammal.
(You realise, of course, that you could do the whole "We Don't Talk About" number with traumatised ex-companions? Ian and Barbara as Félix and Pepa, still recovering from their abduction. A jumpy, paranoid Ace as Dolores. The doomed Kamelion as Camilo, because EVEN THE NAME...)
J. K. Rowling has already stated that she isn't anti-cat and that she has nothing against this cat in particular, but that it *should* be immediately put down in case it exposes itself to a squirrel.
ME: Has conditioning-by-trope really debased our idea of humour to such a level that you can give the impression of having constructed a joke just by making a banal cultural observation and adding a generic punchline?
INTERVIEWER: I meant, do you have any questions about the job.
2022: anti-vaxxers begin a campaign to end the ban on dumping bodies into the river. "Next thing you know, they'll be telling us we can't even cannibalise our grandparents," say Right Said Fred.
Des Lynam publicly endorsed UKIP. Jimmy Hill defended footballers using racial abuse against black players.
The British right, always trying to take refuge in a "non-political" past that never existed.
Funny how David Coleman Jimmy Hill & Des Lynam all managed to present MOTD without voicing political views or attacking the government
They also paid their taxes🤔
Right, now "Strictly" is over, it's too late to do the joke about Tom Baker hiding in the tree. However, I would absolutely bet money that this episode happened because Russell T. challenged himself to write a story with the longest corridor in
#DoctorWho
history. HE'S LIKE THAT.
Don't get me wrong, I do love Roger Delgado: engaging, inventive, brilliant as a physical performer. But I've never once seen him play Foreign Accent Guy in a '60s or '70s action drama and been sure what the accent is. He's generally a Franco-Spanish Turk from communist Mongolia.
@2niposting
"Transit" (the most underrated Doctor Who story of all time) and "The Also People" both identify the Doctor with Shango, the divine Yoruba spirit of thunder. There's a strong West African influence in a lot of Ben Aaronovitch's work, for family reasons (his wife) if nothing else.
I don't have a smartphone, so I can't post selfies. But here's my genome. GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCATGTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAGCTAGAAGAAAAGCATTGGGAAGTTTCCAACATG (1/21,820,229)
I'm 51. One of the first things my grandparents told me about war was that although they liked to remember the let's-beat-this-together moments (community in the bomb shelters, Gracie Fields, etc), overall it was a murderous nightmare.
I'm amazed anyone can still be this stupid.
Henry Kissinger dying at the age of 100 (not 98, not 103, but exactly 100) gives off real Faustian Pact energy. "I wish to be one of the most powerful men on Earth, and also to cop off with Jill St John." "Very well, mortal. But after your time of 100 years -"
"Deadname" sounds like a great arch-enemy for a trans superhero.
Has the ability to impersonate any human being, but can only copy who they *used* to be, not who they are now.
The Clitoris is actually an alien parasite brought back to Earth by Valentina Tereshkova, the first woman in space. This is why nobody remembers hearing about it before 1963. (A fictionalised version of these events can be found in the 1960s BBC serial "Quatermass and the Clit".)
What's interesting about Elon Musk is that he's obsessed with the future, yet behaves in a way that guarantees the people of the future will remember him as a prick. He dreams of a society where nobody likes him.
@AndyRileyish
Do Galton and Simpson count as a single figure? "Hancock's Half Hour" and "Steptoe and Son" are the reasons UK sitcom ended up like *that* rather than like "The Honeymooners", and everything else follows on from there.
Today's awful thought: children growing up today will know that "record scratch" signifies "sudden and awkward interruption", but will have no idea what an actual record scratch is or why the sound effect is like that.
Somewhere in this house, in one of many, many boxes full of interlocking plastic, is the most valuable single item I own.
It's comforting to know that if I'm ever burgled, they can take the laptop and the TV but I'll have the last laugh.
I liked almost every part of that
#DoctorWho
. None of them belonged in the same story, it was a terrible mess. But I liked them individually.
It'd be nice to see the actual, fully-developed story of The Giggle, without the last half of the episode just being continuity business.
Now he's writing for a Disney-led audience that may not even have heard of
#DoctorWho
, it's more important than ever to build up the "real world" before smashing it down with monsters. I hadn't realised how much time "Ruby Road" spends on the civilians, or just how well it works.
In the last week of her US tour, Taylor Swift surprises fans by re-enacting the whole of "Planet of the Daleks" episode five. "Like the Skaroine horrors, I too wish I could sometimes be invisible," she tells Rolling Stone.
Has a vaccine booster today, and now I'm eating something I reheated even though it says "do not reheat" on the packet.
What I'm saying is that if I'm dead by tomorrow, please don't let anti-vaxxers claim it was the vaccine. It was my refusal to throw away lovely once-warm food.
Yeah, here it comes.
I regret an awful lot of things I've said on this platform while drunk, most of them self-destructive. But I'm getting drunk *specifically* for what I'm going to say next.
Those who've known me for any length of time... you can guess, can't you? Mm-hmm.
The sheer balls of the person who first wrote "fee-fi-fo-fum, I smell the blood of an Englishman". Inventing a whole string of nonsense to rhyme with their second line, then not bothering to make it rhyme with their second line.
Right! I've decided I should try to make a YouTube channel. How do I do that, then?
I'll probably need a camera of some sort. Also... editing... things? Software. All of that nonsense. And one of those ring-shaped lights you stick your face into like you're in a gurning contest.
Arrr, I were sold a treasure map that showed where a thousand doubloons were buried in a secret vault, but all I found there were worthless NFTs. An' that's what ye get for investin' in a crypt o' currency.
Animators in executioners' hoods carry a guillotine to the studio during the Disney strike of 1941. (It's long been rumoured that the man in the lead is Chuck Jones. He *was* present, having been a lifelong union man. But it's probably not him with the sign, sadly.)
#GreatStrikes
There really should be a video game like this. No story or characters, just a static screen where you have to stay alive as long as possible even though the environment keeps fast-cutting around you.
Moffat is an abusive misogynist scumbag, to a degree I wasn't even aware of when I used to take the piss out of him via blog. There are people who could wreck his reputation (and possibly, by association, that of
#DoctorWho
) with one tweet, but don't. Why...? (1/3)
When you've been trapped in the Renaissance by a rival Time Lord and have to do the "hey nonny nonny, in the future everyone will have horseless chariots" routine for the eightieth time.